RHS READING CENTER!

morphology of caulerpa

December 5, 2020

R: a language and environment for statistical computing. Dreher, T.W., D.B. 2013). Phylogenetic trees were constructed by Bayesian inference (BI) using MrBayes v.3.1.2 [60]. Grant. Vienna, Austria. Similarly, C. racemosa var. 2009. The results presented here indicate not only fundamental differences in the mechanisms of wound plug formation in different genera of the Siphonales (Menzel 1988, Welling et al. Comparison of the wound-activated transformation of caulerpenyne by invasive and noninvasive Caulerpa species of the Mediterranean. The character-based identification of the species of Caulerpa by using the 18S rDNA insertion sequence was another useful identification tool that we found in this study. Infantes, E., J. Terrados and A. Orfila. ed. 2011, Varela-Álvarez et al. Wright and A.R. And, at least in the aquarium hobby, the genus name is also used as their common name. 2010. Thus, there was no consistent pattern observed in the relationship between morphological characters and placement in the phylogenetic tree of taxa based on the molecular markers investigated. The nucleotide divergence varied from 0.003 to 0.301 within species whereas interspecific variation ranged from 0.04 to 0.661. 94°C ⁄ 5 min; 35cyclesof 94°C ⁄ 1min, 52.4°C ⁄ 1 min 72°C ⁄ 2min; final extension 72°C ⁄ 5 min, 94°C ⁄ 5 min; 35 cycles of 94°C ⁄ 1 min, 52.4°C ⁄ 1 min, 72°C ⁄2 min; final extension 72°C ⁄5 min, 94°C ⁄ 5 min; 35 cycles of 94°C ⁄ 45 sec, 41.5°C ⁄ 45 sec, 72°C ⁄2 min; final extension 72°C ⁄10 min, 94°C ⁄ 5 min; 35 cycles of 94°C ⁄ 1 min, 50°C ⁄ 1 min, 72°C ⁄2 min; final extension 72°C ⁄5 min, p1 = 1-1076\3 p2 = 2-1076\3 p3 = 3-1076\3. The present results also agree with the study of Olsen et al. The difficulty in amplification of COI-5P [36] and the absence of matK from green algae (except Charophyte [37]) make them inappropriate candidates for barcoding in Caulerpa. laetevirens f. laxa by Børgesen [65] and with C. racemosa var. The secondary metabolites from the Caulerpa were also reported to have various biotechnological and pharmacological applications [16]. Within similar regions, spectra were averaged and areas with distinct chemical compositions were classified. Morphology and Distribution of Caulerpa lentillifera J. Agardh (Chrolophyceae) in Japanese Waters, Including the First Record from Southern Kyushu and Northern Ryukyu Islands Furthermore, the results confirmed that C. racemosa var. The intensity of the Raman bands vs. the distance from the cut are depicted for β-carotene at 1527 cm-1 (orange diamonds), the carbon triple bond of caulerpenyne and its derivatives at 2180/2187 cm-1 (green squares), as well as the characteristic wound plug bands at 1186 (gray triangles), 1572 (A) or 1582 (B) (gray circles) and 1627 (A) or 1610 (B) cm-1 (black triangles). The specimen C06 was identified as C. microphysa characterized by far fewer vesicles that are not clear in longitudinal series on the axis, short assimilators up to 3.0 cm and spherical ramuli up to 2.0 mm diameter (Figure S5 in File S1). Wound closure in the invasive green alga Caulerpa taxifolia by enzymatic activation of a protein cross-linker. Invasions3: 201–210. [31], the monophyletic association of taxa in phylogenetic trees [41] and 18S rDNA introns by character-based analysis as a DNA barcode to identify Caulerpa species. Performed the experiments: MAK CRKR BJ. PCR products were purified and subjected to commercial sequencing (Macrogen Inc., Korea). These are characteristic of caulerpenyne and caulerpenyne derivatives, which are involved in protein cross-linking (Figure 1) (Weissflog et al. In these rare cases, the band of the carbon triple bond is found in half of the spectra at 2172 cm-1 or as a shoulder of the band at 2187 cm-1 in the second half of the spectra. [17] suggested the need for detailed study of the C. racemosa complex, which harbours a number of varieties and forms. Plots of the Raman band intensities of selected metabolites in relation to the distance from the cut of (A) C. prolifera and (B) C. taxifolia. The FT-Raman results presented here are also in agreement with kinetic studies of the wound-activated caulerpenyne transformation (Jung et al. These insertion sequences were reported by Kooistra [40] in two Caulerpacean specimens, and were utilized by Durand et al. However, there is a single valid ITS rDNA sequence available for C. cupressoides in GenBank dataset and more sequences will be required for differentiating the C. cupressioides and C. serrulata as monophyletic lineages. by enzymatic activation of a protein cross-linker. The morphological development of the wound plug of Caulerpales has been well described and the fundamental biochemical transformations leading to its formation have also been characterized (Menzel 1988, Welling et al. The study supports the use of the tufA gene as a preferred marker with the monophyletic association of taxa as the main criteria for identification at the species level. Coppejans and Beeckman [69] considered C. lentillifera and C. microphysa as separate species. There is a strong resemblance of these specimens to the description of C. racemosa var. Further studies must focus on the identification of the specific compounds within both the internal and the external wound plugs. 2009). Tetrahedron 57: 7169–7172. form a polymer wound plug that seals their giant cells after mechanical injury, in order to prevent fatal loss of cell material. The C. racemosa and varieties were positioned in four different lineages. Wound closure in the invasive green alga. Similar findings have been reported by Fama et al. The average divergence over all sequence pairs was 0.043. Williams, S.L. Molecular data confirmed the identification of 10 distinct Caulerpa species: C. veravalensis, C. verticillata, C. racemosa, C. microphysa, C. taxifolia, C. sertularioides, C. scalpelliformis, C. serrulata, C. peltata and C. mexicana. The divergence between morphologically different species C. serrulata and C. cupressoides was exceptionally low (from 0.003 to 0.004). Peaks: Peaks. Solid lines on the right indicate possible clades. However, there are significant differences in the chemistry of the wound plugs between the species. Biol. The averaged spectra of wound plugs from both species showed significant contributions of β-carotene at 1156 and at 1527 cm-1 (Figure 3). This comparative investigation was performed with Caulerpa taxifolia and Caulerpa prolifera, which were cut under water between the stolon and the assimilator with a razor blade to initiate the wounding in a reproducible manner. The major addition to these phylogenetic analyses was C. veravalensis, which was recovered as a sister lineage to C. racemosa var. Minimum interspecific distances and maximum intraspecific distances were calculated for each species identified and named by traditional taxonomical features. C. peltata (C19 and C28) formed a separate lineage with the species that were mostly characterized by turbinate, trumpet or peltate ramuli (pp=1.0). Some genus of brown (e.g. 2009) but also more subtle differences at the species level. Chrysophytes (Golden-brown algae) Synedrais a bilaterally symmetrical, rod-shaped diatom. Duraiswamy [8] categorized the Indian Caulerpa species into five sections. Funding: The financial assistance received from Council of Scientific and Industrial Research (www.csir.res.in), New Delhi (CSC0116: BioEn) is duly acknowledged. This study characterized and compared distinct populations of sea grapes from selected regions in the Philippines and described the influence of physicochemical parameters of seawater on their morphology. : e47728. 2012. However, the highly conserved nature reduces the genetic distance between species in pairwise distance analysis if the complete locus is utilized [39]. Following this work, the taxa investigated in this study can be grouped into three sections, i.e. Most of these lineages can be resolved into separate species. CAACCTGGTTGATCCTGCCAGT TGATCCTTCTGCAGGTTCACCTAC, GCTTATGCWAAAACATTYCAAGG AATTTCTTTCCAAACTTCACAAGC, TGAAACAGAAMAWCGTCATTATGC CCTTCNCGAATMGCRAAWCGC. Stam et al. Each analysis consisted of three heated and one cold Markov chains. Raman spectroscopic insights into the chemical gradients within the wound plug of the green alga Caulerpa taxifolia. Caulerpenyne and caulerpenyne transformation product derived signals are indicated by #, carotene derived signals by *. Specimen C14, however, with erect assimilators up to 10 cm long, and densely covered with spherical to sub-spherical ramuli and ramuli with constricted pedicels, was identified as C. lentillifera (Figure S11 in File S1). Mediterranean species of Caulerpa are polyploid with smaller genomes in the invasive ones. The detailed morphological descriptions, images and references used for identification [43-56] for collected specimens are given in the supporting information (Figures S1-S19 in File S1). by boat anchors and its resistance to desiccation. Patterns of wide-scale substation within meadows of the seagrass Posidona oceanica in NW Mediterranean Sea: invaders are stronger than natives. A desulfatation-oxidation cascade activates coumarin-based cross-linkers in the wound reaction of the giant unicellular alga, West, E.J., P.B. A desulfatation-oxidation cascade activates coumarin-based cross-linkers in the wound reaction of the giant unicellular alga Dasycladus vermicularis. A neighbour-joining (NJ) tree was constructed by the bootstrap resampling method with 1,000 bootstrap replications in MEGA v.5 [59]. Gametophytic Phase of Marchantia 4. Additionally, the effective asexual reproduction based on mechanical fragmentation of C. taxifolia and subsequent distribution of the fragments contributes to its spread (West et al. How do giant plant cells cope with injury-the wound response in siphonous green algae. [23] for tufA-gene-based phylogenetic analysis in Caulerpa. The spectra were averaged after sorting into different zones. Morphology of Caulerpa taxifolia a: frond b: pinnules c: secondary frond d: stolon e: rhizoidal bouquet f: rhizoidal pillars g: rachis adapted from D. Chiaverini, LEML Photo: N. Coleman, World of Water Caulerpa taxifolia legislation In December 1994, scientists assigned to study the problem Results are illustrated for one wound plug of each species (Figures 4(A) and 4(B)). Specimens were stored at -20°C before genomic DNA isolation. turbinata (as C. chemnitzia) by De Toni [9], although subsequent studies added several species. Saunders and Kucera [36] evaluated several markers for marine green macroalgae, albeit not Caulerpa, and proposed tufA as the preferred barcode. Subsequently, Svedelius [7] investigated the biodiversity of Caulerpa from Ceylon (Sri Lanka) following the work of Agardh [8]. [2-4]. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Citation: Kazi MA, Reddy CRK, Jha B (2013) Molecular Phylogeny and Barcoding of Caulerpa (Bryopsidales) Based on the tufA, rbcL, 18S rDNA and ITS rDNA Genes. Only measurements where no damage of the experimental organisms was observed were considered for further analysis. The wound response in the siphonous alga Caulerpa simpliciuscula C. It closely resembles C.taxifolia but can be distinguished by the form of its branches, which are curved towards the interior in the latter and straight in the former. [ 17 ] suggested the need for detailed study of the C. racemosa complex, which harbours a number of varieties and forms. Genomic DNA was isolated by a modified CTAB DNA extraction method [57]. In NJ analysis of tufA and ITS rDNA, most of the clades were recovered as being monophyletic with strong support with few exceptions. These species have formed separately placed clades in the phylogenetic trees. [18] also reported the presence of six different lineages in the C. racemosa-peltata complex. Hawthorne, D.B., T.W. In the present tufA analysis, all C. scalpelliformis specimens from India (C01, C12 and C21) clustered with C. scalpelliformis var. Assessment of substratum effect on the distribution of two invasive Caulerpa (Chlorophyta) species. The maximum intraspecific genetic distance (0.010) exceeds the minimum interspecific distance (0.004) in the present dataset. Welling, M., G. Pohnert, F. Küpper and C. Ross. The Bayesian phylogenetic tree of the tufA gene (Figure 4) supported the differentiation of species depicted in the NJ tree. Introduced species in seagrass ecosystems: status and concerns. Rapid biopolymerisation during wound plug formation in green algae. Volume 57, Issue 1, Pages 1–7, eISSN 1437-4323, ISSN 0006-8055, Classical and Ancient Near Eastern Studies, Library and Information Science, Book Studies. In C. taxifolia, these signals appeared at 1556, 1582 and 1610 cm-1 (Weissflog et al. Arrows in (B), (D), and (E) indicate positions of the cut; WP, wound plug; EWP, external wound plug; IWP, internal wound plug. Systematic Position of Marchantia 2. 1981. 2005. A region with comparable spectroscopic signatures could not be identified in C. taxifolia. 2011. Citation: Botanica Marina 57, 1; 10.1515/bot-2013-0072. These taxa may be considered as part of a new C. veravalensis complex and need further detailed investigations. Bames, J.T. Introduction . (E) Schematic diagram of the wounded area of C. taxifolia and C. prolifera based on Raman spectroscopic results. Cottalorda, A. Djellouli, A. El Adeb, C. Orestano, A.M. Grau, L. Ivesa, A Jaklin, H. Langar, E. Massuti-Pascual, A. Peirano, L. Tunesi, J. de Vaugelas, N. Zavodnik and A. Zuljevic. The stability of the rbcL exon, with high amino acid sequence similarity, makes it another useful and reliable marker for such studies [38]. Fucus) and red (e.g. Given that plastids are found in the cytoplasm, local maxima are expected there. A new species, C. veravalensis, containing narrow, linear, non-overlapping, flat pinnules with a rounded apex was described from Veraval, Gujarat, India [10]. These specimens were characterized by a pinnately divided flat broad midrib, opposite to alternate flat ramuli with a rounded apex and occasional bifurcation in apices of ramuli (Figure S9 in File S1). A wide range of molecular markers has been employed in the past to decipher the identification and phylogeny of the genus Caulerpa [18-30]. : the effect of wounding on carbon flow. There are around 844 species of seaweeds along (C03, C13) showed no sequence difference with C. veravalensis, and these clustered together. Morphology of Caulerpa taxifolia a: frond b: pinnules c: secondary frond d: stolon e: rhizoidal bouquet f: rhizoidal pillars g: rachis adapted from D. Chiaverini, LEML Photo: N. Coleman, World of Water Caulerpa taxifolia legislation In December 1994, scientists assigned to study the problem by the European Commission, issued the "Barcelona The results can provide a chemical rationale for the observed morphological differences in the wound plug regions of both algae. The details of the molecular markers, primers and amplification conditions utilized in this study are summarized in Table 1. Additionally, intensity profiles of prominent Raman bands related to the distance from the cut were determined for individual wound plugs. 2009. [Keywords: Caulerpa, Marine Macroalgae, Morphology Variation, Indian coast, Intertidal area.] No sequence difference was observed for C. microphysa (C06) and C. lentillifera (C14), which clustered together. 2011. Variations in the Structure, Morphology and Biomass of Caulerpa taxifolia in the Mediterranean Sea Fatty Acid Composition of Green Algae of the Genus Caulerpa Impact of UV-A and UV-B Irradiance on the Patterns of Pigments and 15N-Ammonium Assimilation of the Tropical Marine Diatom Bellerochea yucatanensis Menzel, D. 1988. Furthermore, these two taxa showed no difference in rbcL gene sequence. West, E.J., P.B. It was also concluded from the results that the specimen identified previously as C. microphysa and C. lentillifera could not be considered as separate species. A species in the Mediterranean can have a stolon more than 3 … morphology in Caulerpa. Philippines as “lato” or “ar-arusip”, are economically important macroalgae belonging to the edible species of the genus Caulerpa. The pairwise distance analysis of tufA gene data showed the intraspecific variation ranged from 0.0 to 0.011 whereas interspecific variation ranged from 0.003 to 0.173. From the phylogenetic trees, it was inferred that both these taxa grouped together into a single clade. Primer details and PCR conditions used for the amplification of 18S rDNA, ITS rDNA, IUPAC nucleotide ambiguity codes: W= A/T, Y= C/T, M= A/C, N=. C. racemosa var. Introduced species in seagrass ecosystems: status and concerns. 2001. Caulerpa is a genus of seaweeds in the family Caulerpaceae (among the green algae). Analysis of the cytochrome distribution via linear and nonlinear Raman spectroscopy. 2005, Welling et al. Contributed reagents/materials/analysis tools: BJ. III: Composition and origin of the wound plugs. The rbcL gene was also found to be least variable in comparison with tufA and ITS rDNA (Figure 2). Aside from these rather general similarities, the wound plugs of C. taxifolia and C. prolifera differ distinctly. J. Exp. The aquaria were filled with 7–20 l of artificial seawater (Instant Ocean, Aquarium Systems, PSU 24), and the water temperature was kept constant at 22°C. This study aimed to determine the identification and phylogenetics of the Indian Caulerpa species by employing multiple markers. 2002. Using hot glue, a glass frame was constructed from two capillaries. Therefore, in both species, the direct participation of caulerpenyne and its derivatives in the wound reaction is shown in vivo. In total, 29 Caulerpa specimens (20 species including seven varieties and three forms and two unidentified taxa) were investigated based on the morphological differences for molecular barcoding and phylogenetic analysis. URL, Varela-Álvarez, E., A.G. Garreta, J.R. Lluch, N.S. The empirical and monitoring data presented indicates that multiple environmental and biological factors will influence the domestication and aquaculture of Caulerpain Fiji, primarily temperature and substrate for the attachment of individuals. This study was supported by the Carl-Zeiss Foundation and a PhD scholarship to K.G. R: a language and environment for statistical computing. De Senerpont Domis et al. Williams, S.L. Morhac, A. In this work, we introduce a comparative Raman spectroscopic study of the wound plug formation in the invasive Caulerpa taxifolia (Valh) Agardh, 1817 and the non-invasive Caulerpa prolifera J.V. Ecol. ISBN 3-900051-07-0. DOI: 10.1371/journal.pone.0047728. Nature 408: 157–158. [Keywords: Caulerpa, Marine Macroalgae, Morphology Variation, Indian coast, Intertidal area.] Jung, V. and G. Pohnert. In the rbcL-gene-based analysis, the position of certain taxa did not resolve sufficiently and also showed incongruence with other datasets. A spectral resolution of 2 mm-1 was chosen, and each spectrum was averaged in 30 scans. 2012. The molecular marker ITS rDNA shows high variability in its sequence as well as in its length, which can be exploited for comparing the Caulerpa populations at the inter- and intraspecific levels [19]. Spectra were recorded at an excitation wavelength of 1064 nm with a laser power at the sample of 800 mW. Apparently, the chemical composition is similar overall, but there are subtle differences between the species. If the inline PDF is not rendering correctly, you can download the PDF file here. The additional sequences were retrieved from GenBank in order to compare the inter- and intraspecific nucleotide divergences and to produce the phylogeny of Caulerpa as complete as possible using the currently available data. The 18S nuclear rDNA has been widely used in phylogenetic studies since it comprises highly conserved regions among the species and shows a high degree of functional constancy with a slow evolutionary rate. Biomass fresh weight and biomass attributes (frond length, width and grape The intensities of the carbon triple bonds of caulerpenyne and its derivatives exhibit a distinct maximum located within zone II of C. prolifera, and at the border between the internal wound plug and zone II of C. taxifolia. In wound plugs of both species, compared with intact algal tissue, new bands appeared between 1500 and 1700 cm-1 (Figure 3(E)), as did a band at 1186 cm-1 (Figures 4(A) and 4(B)). acknowledges the support provided by the Volkswagen Foundation. 2010. Background measurements of the experimental setup without a sample revealed that neither the glue nor the holding capillaries contributed to the analyzed Raman signals. Wright and A.R. e82438. Disruption-free imaging by Raman spectroscopy reveals a chemical sphere with antifouling metabolites around macroalgae. The first taxonomically identified species of this genus from the Indian coast were Caulerpa serrulata (as C. freycinetii), C. lessonii and C. racemosa var. Wrote the manuscript: MAK CRKR BJ. As an accessory pigment for photosynthesis, β-carotene is associated with the plastids. The position of C. serrulata also differed in rbcL phylogeny in comparison to tufA and ITS rDNA phylogenetic analyses. 2007. Published: 22 October, 2012. Two specimens, C05 (collected from the western coast of India) and C20 (collected from the eastern coast of India), had cylindrical, sometimes laterally compressed, ramuli that were radially arranged on assimilators (Figure S4 in File S1). Soler, A.A. Serrao and M.A.R. Below: Chemical structure of β-carotene. Duraiswamy [8,12,13] prepared a comprehensive account of Caulerpa describing 21 taxa from the Indian shores based on morphological, cytological, anatomical and secondary metabolites (caulerpin, caulerpicin and β-sitosterol). G.P. While C. taxifolia forms an external wound plug within the first seconds after wounding and additionally a chemically distinct internal wound plug within the first minute, C. prolifera just forms a single chemically homogenous wound plug region. R Foundation for Statistical Computing. For example, the incongruity was observed in the position of C. flexilis as it formed a separate lineage in tufA gene analysis and clustered with C. okamurae, C. microphysa and C. lentillifera in the rbcL gene phylogenetic tree. The insertion and deletion pattern in insertion sequence was species specific and could be utilized for species-level identification by a character-based approach. 2013. The 50 per cent majority rule consensus tree was obtained after discarding 25% of sampled trees as burn-in. Reduction of herbivory through wound-activated protein cross-linking by the invasive macroalga. 2010. The NJ tree (Figure 1) revealed the presence of 19 distinct well-supported clades. Hawthorne and B.R. The wound response of the siphonous green algal genus. The intensities of the bands vary between the single spectra within a wound plug and between individual wound plugs due to randomly captured plastids. De Senerpont Domis et al. We would further like to thank Chief Conservator of Forest, Marine National Park Jamnagar, Government of Gujarat and Chief Wild Life Warden, Gulf of Mannar Biosphere Reserve, Government of Tamil Nadu for permitting the sample collection. Nucleotide substitution models for respective datasets for Bayesian analysis. The averaged spectrum of the wound plug of Caulerpa prolifera (A), and the external (B) and internal (C) wound plugs of C. taxifolia. C. racemosa var. Assessment of substratum effect on the distribution of two invasive. 1982. Jousson, O., J. Pawlowski, L. Zaninetti, F.W. Sample ID for specimens from this study and accession numbers for the reference sequences are given for identification in Table S1.

Win A Bass Guitar 2020, Dripping Mud Font, Jaanvika Name Meaning In Telugu, St Louis Zoo Jobs, Animals With Pouches List, Spanish As A Foreign Language Curriculum, How To Catch Atlantic Bonito,

No Comments

Leave a Reply

Your email address will not be published. Required fields are marked *